FEBS Letters
Volume 582, Issue 7 , Pages 1025-1031, 2 April 2008

A role for p38α mitogen-activated protein kinase in embryonic cardiac differentiation

Edited by Lukas Hüber

  • Francisco Hernández-Torres

      Affiliations

    • Departamento de Biología Experimental, Facultad de Ciencias Experimentales, Universidad de Jaén, Paraje de las Lagunillas, s/n, 23071 Jaén, Spain
    • ,
  • Sergio Martínez-Fernández

      Affiliations

    • Departamento de Biología Experimental, Facultad de Ciencias Experimentales, Universidad de Jaén, Paraje de las Lagunillas, s/n, 23071 Jaén, Spain
    • ,
  • Susana Zuluaga

      Affiliations

    • Departamento de Bioquímica y Biología Molecular II, Facultad de Farmacia, UCM, Ciudad Universitaria, 28040 Madrid, Spain
    • ,
  • Ángel Nebreda

      Affiliations

    • CNIO (Spanish National Cancer Center), Madrid, Spain
    • ,
  • Almudena Porras

      Affiliations

    • Departamento de Bioquímica y Biología Molecular II, Facultad de Farmacia, UCM, Ciudad Universitaria, 28040 Madrid, Spain
    • ,
  • Amelia E. Aránega

      Affiliations

    • Departamento de Biología Experimental, Facultad de Ciencias Experimentales, Universidad de Jaén, Paraje de las Lagunillas, s/n, 23071 Jaén, Spain
    • Corresponding Author InformationCorresponding authors. Fax: +34 953 211875 (F. Navarro), +34 953 211875 (A.E. Aránega).
    • ,
  • Francisco Navarro

      Affiliations

    • Departamento de Biología Experimental, Facultad de Ciencias Experimentales, Universidad de Jaén, Paraje de las Lagunillas, s/n, 23071 Jaén, Spain
    • Corresponding Author InformationCorresponding authors. Fax: +34 953 211875 (F. Navarro), +34 953 211875 (A.E. Aránega).

Received 17 December 2007; received in revised form 22 January 2008; accepted 21 February 2008. published online 29 February 2008.

Article Outline

Abstract 

Cardiac differentiation involves cross-regulation of several transcription factors, such as Mef2C, regulated by p38α MAP kinase. We analysed the role of p38α in cardiac differentiation. Either the absence or inhibition of p38α impairs MEF2C nuclear localization in cardiomyocytes, colocalising with vimentin at the perinuclear region. As a consequence, expression of the Mef2C targets, ANF and myocardin, is drastically downregulated. In contrast, Mlc2v and crt are mainly unaltered, probably by the strong Mef2B upregulation, conpensating for the impaired Mef2C transactivity. In addition, p38α deficiency leads to a decrease in the phosphorylated Mlc2v fraction and α-actinin accumulation causing sarcomere disorganisation. We propose a critical role for p38α in early stages of cardiac differentiation by modulation of Mef2C localisation and sarcomeric assembly.

Keywords: Cardiomyocyte, Transcription factor, Mef2C, MAP kinases, Cardiac differentiation

 

Back to Article Outline

1. Introduction 

The molecular basis of cardiac differentiation during heart morphogenesis, a complex cellular process that comprises cell proliferation, migration and differentiation is not so well understood [1], [2]. The MADS-box family of transcriptional regulators, myocyte enhancer factor-2 (MEF-2) proteins, have been widely implicated in cardiomyocyte maturation and differentiation [2], [3], [4]. The first Mef2 family members to be expressed during mouse cardiac development are Mef2B and Mef2C, while Mef2A and Mef2D are later expressed [5]. Data from homozygous Mef2C knockout mouse embryos and conditional Mef2CloxP/loxP mice demonstrate an essential role for Mef2C only in early stages of cardiac differentiation, possibly due to functional redundancy by Mef2A in later stages [4], [5], [6]. Regulation of Mef2 function is complex, including protein–protein interactions with other transcription factors and/or transcriptional regulators, phosphorylation by cyclin-dependent kinases, interactions with histone deacetylases, control by Ca2+-dependent signalling cascade and interaction and phosphorylation by mitogen-activated protein kinases (MAPK) [7], [8], [9].

p38 MAPKs were originally shown to be activated in response to stress and proinflammatory cytokines, but non-stressful stimuli also activate them [10]. Four different p38 MAPKs isoforms have been identified: p38α, β, γ, and δ, which may have both overlapping and specific functions [10]. p38α is widely expressed and is the most abundant p38 family member. Loss of p38α has been established to cause embryonic lethality at midgestation due to a placental defect [11], [12]. Different evidences point out to a crucial role for p38 MAPKs in the regulation of Mef2 transcriptional activity during mammalian somite development and myotome formation, as well as in skeletal muscle differentiation [13]. Furthermore, p38α has been reported to physically interact with Mef2C leading to its phosphorylation, which in term regulates its transactivation activity [14]. Similarly Mef2A is a substrate for p38α [15]. Some evidences indicate the involvement of the p38 MAPK pathway and some of their regulators, such as Rac1, in cardiac differentiation [16]. In addition, p38 MAPKs play an important role in the regulation of cardiomyocyte proliferation, hypertrophy, apoptosis and growth response [10], [17], [18], although the precise role of this MAPK in cardiogenesis remains unclear.

We report here, that p38α plays a critical role in early stages of cardiac cell differentiation through an operative p38α/Mef2C pathway. Lack or inhibition of p38α results in Mef2C mislocation, which prevents nuclear localization, probably through blockage of p38α-mediated Mef2C phosphorylation. This correlates with a decrease in the expression of some cardiac Mef2C targets, such as the atrial natriuretic factor, ANF, and myocardin. In contrast, expression of other Mef2C targets is not altered, probably through compensation mediated by the upregulation of Mef2B expression. In addition, p38α regulates sarcomeric assembly through regulation of ventricular myosin light chain 2 (mlc2v) phosphorylation and insertion into sarcomeric units, as well as the accumulation of α-actinin.

Back to Article Outline

2. Materials and methods 

2.1. Cell lines and culture conditions 

p38α−/− and wild-type embryonic cardiomyocytes were isolated from E 9.5 embryos obtained by intercrossing mice heterozygous for p38α and those carrying large T antigen under the control of a temperature interferon-γ (IFN-γ)-inducible H-2K promoter (immorto transgene) [19]. Cardiomyocytes were isolated as previously described [12] and were grown on collagen-coated tissue culture plates in DMEM containing 10% fetal bovine serum (Invitrogen), IFN-γ (10U/ml; SIGMA), and cardiotrophin-1 (0.2ng/ml; R&D Systems, Minneapolis, MN) at 33°C in humidified atmosphere of 5% CO2.

p38 inhibitor, SB203580, was dissolved in DMSO and added directly to the culture medium to a final concentration of 2.5μM. Cells were incubated in the presence of the inhibitor for up to 48h.

2.2. mRNA extraction and reverse transcription 

Total RNA was extracted from mouse p38α−/− and wild-type cardiomyocytes, using the eukaryotic Perfect RNA mini-kit (Eppendorf) according to the manufacturer’s guidelines. Genomic DNA was removed by treatment with RNase-free DNase (Roche) for 1h at 30°C. First-strand cDNA was synthesized using 1μg of RNA, oligo-dT primers and Superscript RNase H− reverse transcriptase (Invitrogen) (37°C for 1h), following manufacturer’s protocol. As a negative control for genomic DNA contamination, each sample was subjected to the same reaction without reverse transcriptase.

2.3. Quantitative real time PCR (Q-PCR) 

Real-time PCR was performed within an iCycler PCR thermocycler (Bio-Rad, Spain) and SYBR Green detection system (Bio-Rad). Reactions were performed in 96-well plates with optical sealing tape (Bio-Rad) in 20μl total volume containing cDNA corresponding to 150ng of total RNA. Mouse β-actin was used as internal control [20]. Each PCR reaction was performed at least five times to obtain a representative average. The relative level of expression of each gene was calculated as the ratio of the extrapolated levels of its expression and β-actin mRNAs. The amplification PCR products were analysed in agarose gel electrophoresis.

The primers used were as follows (all 5′–3′):

 
SequenceSize of cDNA amplification (bp)
GATA-4501CCGAGGGTGAGCCTGTATGTAATGCC182
301CCGAGGGTGAGCCTGTATGTAATGCC
GATA-5501GTCAACCGACCGCTAGTGAGGC182
302CATTGCCAGTGGCCTTGGCAC
GATA-6501AGTGGCTCTGTCCCTATGACTCC221
302GGATGTGACTTCGGCAGGGG
Mef2A501GTAGCGGAGACTCGGAATTG221
301ATCTTCTTTCGCCCCATTTT
Mef2B501CTGGAGAGAAGCTGCTGAGG234
301CAAGGTGGCTTGGAGAGAAG
Mef2C503AGAAGAAACACGGGGACTATGGG344
303GGGGTGAGTGCATAAGAGGAG
Mef2D501CAGCAGCCAGCACTACAGAG208
301ACTTGGCAGGGATGACTTTG
Mlc2v501TGTTCCTCACGATGTTTGGG291
301CTCAGTCCTTCTCTTCTCCG
αMHC501CTCAGCCAGGCCAATAGAAT331
302GACTCCATCTTCTTCTTCTGG
βMHC501AGATCGCCCTCAAGGGTGGC196
301AGGTCCTGGAGCCGCAGTAGG
CRT501AGGCTCCTTGGAGGATGATT207
301TCCCACTCTCCATCCATCTC
ANF503CCTGTGTACAGTGCGGTG TC198
303TCTCAGAGGTGGGTTGACCT
Myocardin501ATGCAGTGAAGCAGCAAATG195
301AAGATGCCTGCTCAAAGGAA
β-Actin+374FTGAGGAGCACCCTGTGCT143
−517RCCAGAGGCATACAGGGAC

2.4. Immunocytochemistry 

Wild-type and p38α−/− cardiomyocytes cell lines were grown on collagen-coated cover slides. Cells were washed in PBS twice for 5min and were fixed for 20min in 4% paraformaldehyde at room temperature and hydrated through graded ethanol steps. Cells were briefly rinsed in PBS and blocked at room temperature using TBSA-BSAT (10mM Tris, 0.9% NaCl, 0.02% sodium azide, 2% bovine serum albumin and 0.1% Triton-X100). Rehydrated cells were incubated overnight at room temperature with primary antibodies at 1:200 (anti-vimentin), 1:100 (α-actinin, MLC2v) and 1:50 (Mef2c and Gata4). Gata4 goat polyclonal, Mef2c goat polyclonal rabbit polyclonal antibodies were purchased from Santa Cruz Biotechnology Inc. The rabbit polyclonal antibody recognizing α-actinin and the monoclonal for anti-vimentin were purchased from Sigma. The MLC2v monoclonal antibody was kindly provided by W. Franz Lübeck, Germany.

After rising, cells were incubated for 5h with antirabbit, antigoat or anti mouse Cy3 secondary antibodies (Jackson Labs, USA) diluted in TBSA-BSAT (1:100). Nuclear staining was performed using DRAQ-5 (red Fluorescen Cell-Permeable DNA probe, Biostatus Limited, United Kingdom). Immunofluorescence analysis was carried out in a leica TCS SL confocal microscope (Leica LCS Version 2.0).

2.5. Western blot analysis 

Western blot analysis was carried out as previously described using total cell protein extracts [12]. The rabbit polyclonal antibody recognising phosphorylated MLC2v, muRLCP, was kindly provided by Dr. N.D. Epstein, USA [21]. To normalize an anti-tubulin antibody (Sigma T5168) was used.

Back to Article Outline

3. Results 

3.1. Cardiac transcription factors expression is not dependent on p38α MAPK 

To explore the involvement of p38α MAPK in cardiac differentiation, we used immortalized mouse wild-type and p38α−/− cardiomyocytes from E9.5 embryos. mRNA expression levels for GATA4, GATA5 and GATA6 transcription factors, known to be expressed at early stages of cardiac differentiation [1], as well as Mef2C, the most important member of Mef2 family shown to play a role in early heart formation [5], were analysed by quantitative real time PCR. As shown in Fig. 1A, mRNA levels were similar in both wild-type and p38α−/− cardiomyocytes, indicating that gene expression of these transcription factors is independent of p38α MAPK in these cardiomyocytes cell lines.

  • View full-size image.
  • Fig. 1. 

    Expression levels and localisation of cardiac transcription factors is not compromised in the absence of p38α MAPK. Quantitative RT-PCR analysis of mRNA expression levels for GATA4, GATA5, GATA6 and Mef2C (A) and immunolocalisation of GATA4 transcription factor (B) in wild-type (p38) and p38α−/− cardiomyocytes (p38−/−).

In addition, we performed immunohistochemistry experiments to compare the localisation of GATA4 in wild-type and p38α−/− cardiomyocytes. As expected, GATA4 was localised in the nucleus of wild-type cardiomyocytes and no significant differences were found in p38α−/− cell line (Fig. 1B). Similar results were obtained for Nkx2.5 (not shown).

3.2. Nuclear Mef2C localisation is compromised in the absence of p38α MAPK 

Phosphorylation of Mef2C by p38α MAPK regulates its transactivation activity [7]. To determine whether nuclear localisation of Mef2C could be impaired or altered in the absence of p38α, immunolocalisation of Mef2C was analysed in immortalised wild-type and p38α−/− cardiomyocytes. Fig. 2A illustrates the intranuclear localisation of Mef2C in cultured wild-type cardiomyocytes. In contrast, in p38α−/− cardiomyocytes Mef2C nuclear translocation was mainly impaired (Fig. 2A) remaining in the perinuclear region colocalising with vimentin (Fig. 2B), a component of intermediate filament (IF) [22]. Thus, in contrast to other cardiac transcription factors, which do not appear to be regulated by p38α, Mef2C nuclear localisation seems to be p38α MAPK dependent.

  • View full-size image.
  • Fig. 2. 

    p38α MAPK deficiency or inhibition alters localisation of Mef2C. (A) Immunolocalisation of Mef2C showing its mislocation in the cytosol in p38α−/− (p38α−/−) as compared with wild-type cardiomyocytes (p38α). (B) Co-immunolocalisation of Mef2C and vimentin in the perinuclear region in p38α−/− cardiomyocytes. (C) Inhibition of p38α MAPK with SB203580 (2.5μM) for 24 or 48h, impairs Mef2C nuclear translocation in wt cardiomyocytes. DRAQ5TM (in blue) localises in the nucleus.

To demonstrate that Mef2C mislocation observed in p38α−/− cardiomyocytes was dependent on p38α activation, wild-type cardiomyocytes were treated with the specific p38 inhibitor SB203580 and Mef2C localization was analyzed. Treatment with low doses of SB203580 for 24h led to a defect in Mef2C nuclear accumulation and Mef2C was mainly in the perinuclear region. This effect was stronger after 48h treatment, clearly affecting Mef2C translocation into the nucleus (Fig. 2C). These results confirm those from p38α−/− cardiomyocytes, demonstrating that Mef2C nuclear translocation in cardiomyocytes is dependent on p38α activity.

From the results described above, it can be hypothesized that Mef2C would be functionally inactive in p38α−/− cardiomyocytes. Thus, we analysed the expression of Mef2C gene targets ANF, myocardin, calreticulin (crt) and Mlc2v, markers of cardiac differentiation [23], [24], [25], [26], by quantitative RT-PCR in wild-type and p38α−/− cardiomyocytes. As expected (Fig. 3A), in the absence of p38α MAPK ANF and myocardin drastically decreased. However, crt and Mlc2v mRNA levels were not significantly modified by p38α deficiency (Fig. 3A). This might be a consequence of a compensation exerted by other Mef2 family members, Mef2A, -B and -D, which are also involved in cardiac differentiation and could replace Mef2C, as it has been previously shown [5]. To analyse this possibility Mef2A, Mef2B and Mef2D mRNA levels were analysed by QRT-PCR. In p38α−/− cardiomyocytes, Mef2B expression was about sixfold higher than in wild-type cardiomyocytes (Fig. 3B). In contrast, Mef2A expression highly decreased under p38α deficiency (about 80%), while Mef2D mRNA expression was similar in both cardiomyocytes cell lines. Our results suggest that the increase in Mef2B expression could compensate Mef2C transcriptional activity deficiency and are in line with those previously reported by Lin and co-workers demonstrating that in Mef2C−/− mice embryos, Mef2B was up-regulated by more than sevenfold, probably partially replacing MEF2C [5].

  • View full-size image.
  • Fig. 3. 

    Analysis of the expression of Mef2C targets and Mef2 family members. Quantitative RT-PCR analysis of mRNA levels for the Mef2C targets ANF, myocardin, crt and mlc2v (A) and Mef2A, Mef2B, and Mef2D (B) in wild-type (p38) and p38α−/− cardiomyocytes (p38−/−).

3.3. Cardiomyocytes sarcomeric organisation is altered in the absence of p38α MAPK 

A hallmark of differentiated myocardial cells is the formation and organisation of sarcomeres. Thus, we studied the formation of organised sarcomeres.

We analysed, by QRT-PCR, in wild-type and p38α−/− cardiomyocytes, the expression of myosin heavy chain α-MHC and β-MHC, which are constitutive contractile proteins. The analysis shows that α-MHC and β-MHC mRNA expression was not mainly affected (Fig. 4A), as it was observed for Mlc2v, indicating that p38α does not regulate mRNA expression of contractile proteins. Then, Mlc2v and α-actinin protein expression as well as their incorporation into the sarcomeric units was evaluated by immunofluorescence. In wild-type cardiomyocytes, α-actinin and Mlc2v appeared organised into nascent sarcomeric units (Fig. 4B), indicating that cardiac sarcomeres formation normally occurs in these immortalised cardiomyocytes. However, p38α−/− myocardial cells showed low levels and anomalous distribution of both α-actinin and Mlc2v proteins, suggesting that sarcomere formation, and as a consequence, differentiation of cardiomyocytes is dependent on p38α MAPK. In contrast, localisation of α-MHC and β-MHC proteins in these cells was not altered (data not shown).

  • View full-size image.
  • Fig. 4. 

    Analysis of structural and sarcomeric proteins. (A) Quantitative RT-PCR analysis showing no significant differences between wild-type (p38, squared bar) and p38α−/− cardiomyocytes (p38−/−, dotted bar) in mRNA expression for alfa-MHC and beta-myosin. (B) Immunolocalisation of mlc2v and α-actinin, demonstrate a sarcomeric disorganisation in p38α−/− (p38α−/−) as compared with wt cardiomyocytes (p38α). (C) Inhibition of p38α MAPK with SB203580 (SB) for 48h impairs proper mlc2v incorporation into the sarcomeres, decreases α-actinin accumulation and disorganises the sarcomeres in wt cardiomyocytes. DRAQ5TM (in blue) localises in the nucleus. (D) Western blot analysis of phosphorylated Mlc2v (Mlc2v-p) shows a dramatic decrease in p38α−/− cardiomyocytes (p38α−/−). α-Tubulin was used as a loading control.

Treatment of wild-type cardiomyocytes with SB203580 for 48h, dramatically decreased Mlc2v and α-actinin protein accumulation as it happens in p38α−/− cells (Fig. 4C), leading to a disorganisation of sarcomeric units.

Phosphorylation of Mlc2v by Myosin light chain kinase (MLCK) is required for its assembly into sarcomeres in cardiomyocytes [27]. Unphosphorylated Mlc2v is unable to assemble into the sarcomere, leading to a disorganisation of sarcomeres in ES-derived cardiomyocytes [28]. Thus, p38α MAPK might play a role in MLC2v phosphorylation. This was studied by Western blot analysis using a monoclonal antibody against phosphorylated MLC2v [21]. As shown in Fig. 4D, phosphorylation of MLC2v highly decreased (by 80%) in p38α−/− cardiomyocytes as compared with wild-type cells.

All these results demonstrate that both, sarcomeric organisation and MLC2v phosphorylation are dependent on p38α MAPK in cardiomyocytes. Thus, in the absence of p38α, MLC2v failed to incorporate into the sarcomere, being distributed in the cytosol as short disorganised filaments.

Back to Article Outline

4. Discussion 

p38 MAPKs have been implicated in the regulation of cardiomyocyte proliferation, hypertrophy, apoptosis and growth response [17]. However, the involvement of specific p38 MAPKs isoforms in cardiogenesis is still largely unknown.

Our results demonstrate a dual role for a specific p38 MAPK isoform, p38α, in early stages of cardiac cell differentiation. This dual role implies the existence of an operative p38α/Mef2C pathway where p38α modulates the localisation of Mef2C, which shuttles between the nucleus and the cytoplasm. p38α mediated Mef2C phosphorylation would be a prerequisite for Mef2C nuclear localisation. Therefore, upon p38α inhibition it remains localised at the perinuclear region. In addition, p38α modulates sarcomeric organisation by regulating Mlc2v phosphorylation and α-actinin accumulation. Absence or inhibition of p38α leads to a high decrease in Mlc2v phosphorylation and α-actinin levels, resulting in disorganised sarcomere units.

p38α can physically interact with Mef2C, promoting its phosphorylation, which leads to the regulation of its transactivating activity in the nucleus [14], [15]. Our results demonstrate that Mef2C nuclear translocation would be primarily dependent on p38α-mediated Mef2C phosphorylation as an essential initial step. This is supported by our immunolocalisation data demonstrating that Mef2C nuclear translocation is impaired by p38α deficiency or inhibition, leading to a perinuclear distribution and a co-localization with vimentin [22]. During cardiogenesis, translocation of Mef2C into the nucleus has been also established as a Ca2+ dependent process involving calreticulin and CaN [28], [29]. A cross-talk between p38 MAPK and Ca2+ pathways has been previously proposed [9]. However, we cannot exclude the possibility of the existence of two independent pathways, the p38 MAPK and the Ca2+-dependent pathway, which would regulate Mef2C activity and localisation. According to this, calreticulin, a Mef2C gene target, involved in the regulation of Mef2C nuclear localisation and activity [28], is not altered in p38α−/− cardiomyocytes, suggesting the presence of a correct supply of Ca2+ within the cell [24].

Mef2C is a transcription factor expressed early (at E7.5 in mice) during heart development in vertebrates, whose genetic ablation causes morphological and transcriptional abnormalities during early cardiogenesis [4]. A cooperative interaction between Mef2C and other cardiac transcription factors o transcriptional co-activators is essential for synergistic activation of different cardiac promoters, such as ANF by Mef2C and dHAND, or myocardin by cooperation between myocardin and Mef2C, allowing the correct initiation of the cardiac differentiation program [2], [3], [23], [26], [30], [31]. According to this, in p38α−/− cardiomyocytes, ANF and myocardin expression drastically decrease probably as a consequence of the defect in Mef2C function. These results point out to the alteration of the cardiac differentiation program by disruption of the p38α/Mef2C pathway, which agrees with previous data obtained in neonatal rat ventricular cardiomyocytes maintained in culture, P19 cells and transgenic mice and demonstrate an essential role for Mef2 in the maintenance and differentiation of cardiomyoblast, probably by the existence of a positive regulatory loop between Mef2C, Nkx2.5 and GATA4 [3], [18].

Surprisingly, as it is the case for crt, we found no significant differences in the expression of the Mef2C gene target Mlc2v [24] in p38α−/− cardiomyocytes. This might be a consequence of the upregulation of Mef2B expression, which probably compensates for the lack of Mef2C activity. In contrast, Mef2A expression drastically decreases in p38α−/− cardiomyocytes and Mef2D levels were similar in both cell lines. Interestingly, it has been demonstrated that p38α phosphorylates Mef2A, but not Mef2B and Mef2D [15]. In line with our results, a redundancy between MEF2C and other family members in heart development has been reported in hearts from conditional mef2C (loxP/loxP) mice [6] and Mef2C−/− mice, where Mef2B was proposed to be involved in the induction of Mlc2v expression [5]. All these results suggest that p38α MAPK is required for proper and specific activity of Mef2C and Mef2A and point to the existence of different mechanisms controlling the expression and activity of the four Mef2 members throughout differentiation.

In addition, our results demonstrate that p38α deficiency does not alter either mRNA expression or nuclear localisation of other cardiac transcription factors such as GATA4, GATA5, GATA6 and Nkx2.5 known to play a pivotal role in early cardiogenesis [1], [31]. These results agree with those previously reported in crt−/− mice and cultured crt−/− cardiomyocytes, where Mef2C mislocation in the cytosol does not alter the expression or localisation of GATAs and Nkx2.5 [28].

Sarcomere formation implies the phosphorylation of Mlc2v by MLCK and its insertion into sarcomeric units [27]. Our results demonstrate a p38α-dependent MLC2v phosphorylation, therefore p38α deficiency results in a low amount of phosphorylated Mlc2v. Moreover, p38α deficiency or inhibition results in a cytosolic distribution of Mlc2v as short disorganised filaments and a decrease in the levels of the sarcomeric protein α-actinin, leading to defects in myofibrillogenesis. In vitro, MAP kinase-activated protein kinase 2 (MPAKAPK-2), a substrate of p38α and p38β, phosphorylates MLCK [32]. In addition, activation of MAPKAPK-2 is completely inhibited in rat heart by the p38 inhibitor SB203580 [33], totally impaired in p38α−/− cardiomyocytes [12] and inactive in p38α−/− ES cells [34]. Then, it is likely that a p38α/MPAKAPK-2/MLCK cascade can be functioning in cardiomyocytes, allowing phosphorylation of Mlc2v prior to its assembly into sarcomeric units. Our results also agree with those showing that in Mef2C−/− cardiomyocytes and ES derived-cardiomyocytes expressing a dominant negative form of Rac1, an upstream p38α MAPK activator, myofibrillogenesis is altered, accompanied by compromised cardiac cell differentiation [4], [16].

Taking together, our results point out to a role of p38α MAPK in early cardiac differentiation and are in agreement with Aouadi et al. [35], who demonstrated that p38 activation or inhibition constitutes a switch between cardiomyogenesis and neurogenesis, respectively. They are also in agreement with data demonstrating a role for p38 in mouse lung stem and progenitor cells differentiation [36]. Based on previous data and our own results, we propose the scheme shown in Fig. 5, illustrating the connection between p38α MAPK pathway, Mef2C and sarcomere organisation. In cardiomyocytes, p38α mediates Mef2C phosphorylation as a prerequisite to its translocation into the nucleus. Then, cooperation with other cardiac transcription factors regulates different target genes allowing proper activation of cardiac differentiation program during early stages of development. Activation of MAPKAPK-2 by p38α would allow phosphorylation of MLCK, and then that of Mlc2v as well as its incorporation into sarcomeric units.

  • View full-size image.
  • Fig. 5. 

    A model of p38α-Mef2C pathway and sarcomeric organisation during early stages of cardiac differentiation. The model shown p38α pathway regulating Mef2C phosphorylation as a prerequisite for its translocation into the nucleus. Proper Mef2C nuclear translocation is necessary to its cooperation with cardiac transcription factors and regulation of different target genes for proper activation of cardiac differentiation program during early stages of the development. p38α also regulates Mef2A phosphorylation. Activation of MAPKAPK-2 by p38α allows phosphorylation of MLCK, and then, phosphorylation of Mlc2v prior to its incorporation into the sarcomeric units.

Future studies would be necessary to fully analyse the precise role played by p38α and other p38 MAPKs isoforms as well as the connection with the Mef2 family members in the regulation of cardiac differentiation.

Back to Article Outline

Acknowledgements 

We thank Dr. D. Franco for critical discussion, Dr. Epstein for kindly gift of mRLCP antibodies and Nieves de la Casa for technical assistance in the Leica Confocal Microscope (University of Jaén, Spain). This work was supported by Grants of Ministry of Science and Technology (BFU2007-67575-C03-03/BMC and BFU2005-07727, Spain), Junta de Andalucía (CTS446 and CVI258, Spain) and Fondo de Investigaciones Sanitarias (FIS) PI041131. F.H.-T, S.M. and S.Z. are recipients of predoctoral fellowships from the Ministerio de Educación y Cultura, Spain.

Back to Article Outline

References 

  1. Brewer AC, Alexandrovich A, Mjaatvedt CH, Shah AM, Patient RK, Pizzey JA. GATA factors lie upstream of Nkx 2.5 in the transcriptional regulatory cascade that effects cardiogenesis. Stem Cells Dev. 2005;14:425–439
  2. Peterkin T, Gibson A, Loose M, Patient R. The roles of GATA-4, -5 and -6 in vertebrate heart development. Semin. Cell Dev. Biol. 2005;16:83–94
  3. Karamboulas C, Dakubo GD, Liu J, De Repentigny Y, Yutzey K, Wallace VA, et al. Disruption of MEF2 activity in cardiomyoblasts inhibits cardiomyogenesis. J. Cell Sci. 2006;119:4315–4321
  4. Vong L, Bi W, O’Connor-Halligan KE, Li C, Cserjesi P, Schwarz JJ. MEF2C is required for the normal allocation of cells between the ventricular and sinoatrial precursors of the primary heart field. Dev. Dyn. 2006;235:1809–1821
  5. Lin Q, Schwarz J, Bucana C, Olson EN. Control of mouse cardiac morphogenesis and myogenesis by transcription factor MEF2C. Science. 1997;276:1404–1407
  6. Vong LH, Ragusa MJ, Schwarz JJ. Generation of conditional Mef2c(loxP/loxP) mice for temporal- and tissue-specific analyses. Genesis. 2005;43:43–48
  7. Zhu B, Gulick T. Phosphorylation and alternative pre-mRNA splicing converge to regulate myocyte enhancer factor 2C activity. Mol. Cell Biol. 2004;24:8264–8275
  8. Lu J, McKinsey TA, Nicol RL, Olson EN. Signal-dependent activation of the MEF2 transcription factor by dissociation from histone deacetylases. Proc. Natl. Acad. Sci. USA. 2000;97:4070–4075
  9. Puceat M, Jaconi M. Ca(2+) signalling in cardiogenesis. Cell Calcium. 2005;38:383–389
  10. Han J, Molkentin JD. Regulation of MEF2 by p38 MAPK and its implication in cardiomyocyte biology. Trends Cardiovasc. Med. 2000;10:19–22
  11. Tamura K, Sudo T, Senftleben U, Dadak AM, Johnson R, Karin M. Requirement for p38alpha in erythropoietin expression: a role for stress kinases in erythropoiesis. Cell. 2000;102:221–231
  12. Adams RH, Porras A, Alonso G, Jones M, Vintersten K, Panelli S, et al. Essential role of p38alpha MAP kinase in placental but not embryonic cardiovascular development. Mol. Cell. 2000;6:109–116
  13. de Angelis L, Zhao J, Andreucci JJ, Olson EN, Cossu G, McDermott JC. Regulation of vertebrate myotome development by the p38 MAP kinase-MEF2 signaling pathway. Dev. Biol. 2005;283:171–179
  14. Han J, Jiang Y, Li Z, Kravchenko VV, Ulevitch RJ. Activation of the transcription factor MEF2C by the MAP kinase p38 in inflammation. Nature. 1997;386:296–299
  15. Zhao M, New L, Kravchenko VV, Kato Y, Gram H, di Padova F, et al. Regulation of the MEF2 family of transcription factors by p38. Mol. Cell Biol. 1999;19:21–30
  16. Puceat M, Travo P, Quinn MT, Fort P. A dual role of the GTPase Rac in cardiac differentiation of stem cells. Mol. Biol. Cell. 2003;14:2781–2792
  17. Zuluaga S, Alvarez-Barrientos A, Gutierrez-Uzquiza A, Benito M, Nebreda AR, Porras A. Negative regulation of Akt activity by p38alpha MAP kinase in cardiomyocytes involves membrane localization of PP2A through interaction with caveolin-1. Cell Signal. 2007;19:62–74
  18. Zechner D, Thuerauf DJ, Hanford DS, McDonough PM, Glembotski CC. A role for the p38 mitogen-activated protein kinase pathway in myocardial cell growth, sarcomeric organization, and cardiac-specific gene expression. J. Cell Biol. 1997;139:115–127
  19. Jat PS, Noble MD, Ataliotis P, Tanaka Y, Yannoutsos N, Larsen L, et al. Direct derivation of conditionally immortal cell lines from an H-2Kb-tsA58 transgenic mouse. Proc. Natl. Acad. Sci. USA. 1991;88:5096–5100
  20. Dominguez JN, Navarro F, Franco D, Thompson RP, Aranega AE. Temporal and spatial expression pattern of beta1 sodium channel subunit during heart development. Cardiovasc. Res. 2005;65:842–850
  21. Davis JS, Hassanzadeh S, Winitsky S, Lin H, Satorius C, Vemuri R, et al. The overall pattern of cardiac contraction depends on a spatial gradient of myosin regulatory light chain phosphorylation. Cell. 2001;107:631–641
  22. Yoon M, Moir RD, Prahlad V, Goldman RD. Motile properties of vimentin intermediate filament networks in living cells. J. Cell Biol. 1998;143:147–157
  23. Creemers EE, Sutherland LB, McAnally J, Richardson JA, Olson EN. Myocardin is a direct transcriptional target of Mef2, Tead and Foxo proteins during cardiovascular development. Development. 2006;133:4245–4256
  24. Lynch J, Guo L, Gelebart P, Chilibeck K, Xu J, Molkentin JD, et al. Calreticulin signals upstream of calcineurin and MEF2C in a critical Ca(2+)-dependent signaling cascade. J. Cell Biol. 2005;170:37–47
  25. Zou Y, Chien KR. EFIA/YB-1 is a component of cardiac HF-1A binding activity and positively regulates transcription of the myosin light-chain 2v gene. Mol. Cell Biol. 1995;15:2972–2982
  26. Zang MX, Li Y, Wang H, Wang JB, Jia HT. Cooperative interaction between the basic helix-loop-helix transcription factor dHAND and myocyte enhancer factor 2C regulates myocardial gene expression. J. Biol. Chem. 2004;279:54258–54263
  27. Clement O, Puceat M, Walsh MP, Vassort G. Protein kinase C enhances myosin light-chain kinase effects on force development and ATPase activity in rat single skinned cardiac cells. Biochem. J. 1992;285(Pt 1):311–317
  28. Li J, Puceat M, Perez-Terzic C, Mery A, Nakamura K, Michalak M, et al. Calreticulin reveals a critical Ca(2+) checkpoint in cardiac myofibrillogenesis. J. Cell Biol. 2002;158:103–113
  29. Grey C, Mery A, Puceat M. Fine-tuning in Ca2+ homeostasis underlies progression of cardiomyopathy in myocytes derived from genetically modified embryonic stem cells. Hum. Mol. Genet. 2005;14:1367–1377
  30. Morin S, Pozzulo G, Robitaille L, Cross J, Nemer M. MEF2-dependent recruitment of the HAND1 transcription factor results in synergistic activation of target promoters. J. Biol. Chem. 2005;280:32272–32278
  31. Ueyama T, Kasahara H, Ishiwata T, Nie Q, Izumo S. Myocardin expression is regulated by Nkx2.5, and its function is required for cardiomyogenesis. Mol. Cell Biol. 2003;23:9222–9232
  32. Haydon CE, Watt PW, Morrice N, Knebel A, Gaestel M, Cohen P. Identification of a phosphorylation site on skeletal muscle myosin light chain kinase that becomes phosphorylated during muscle contraction. Arch. Biochem. Biophys. 2002;397:224–231
  33. Clerk A, Fuller SJ, Michael A, Sugden PH. Stimulation of “stress-regulated” mitogen-activated protein kinases (stress-activated protein kinases/c-Jun N-terminal kinases and p38-mitogen-activated protein kinases) in perfused rat hearts by oxidative and other stresses. J. Biol. Chem. 1998;273:7228–7234
  34. Allen M, Svensson L, Roach M, Hambor J, McNeish J, Gabel CA. Deficiency of the stress kinase p38alpha results in embryonic lethality: characterization of the kinase dependence of stress responses of enzyme-deficient embryonic stem cells. J. Exp. Med. 2000;191:859–870
  35. Aouadi M, Bost F, Caron L, Laurent K, Le Marchand Brustel Y, Binetruy B. p38 mitogen-activated protein kinase activity commits embryonic stem cells to either neurogenesis or cardiomyogenesis. Stem Cells. 2006;24:1399–1406
  36. Ventura JJ, Tenbaum S, Perdiguero E, Huth M, Guerra C, Barbacid M, et al. p38alpha MAP kinase is essential in lung stem and progenitor cell proliferation and differentiation. Nat. Genet. 2007;39(6):750–758

PII: S0014-5793(08)00165-8

doi:10.1016/j.febslet.2008.02.050

FEBS Letters
Volume 582, Issue 7 , Pages 1025-1031, 2 April 2008

Article Tools

* Image Usage & Resolution